Journal: bioRxiv

Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

doi: 10.64898/2026.02.09.704693

Figure Lengend Snippet: A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic EPHX2 in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.

Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

Techniques: Immunofluorescence, Imaging, Isolation, Western Blot, Quantitative RT-PCR, Generated, MANN-WHITNEY

Journal: bioRxiv

Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

doi: 10.64898/2026.02.09.704693

Figure Lengend Snippet: A , Diagram of AAV vectors and the workflow of knocking out Ephx2 . AAV was injected subcutaneously. B , Editing efficiency of Ephx2 by amplicon sequencing analysis in hearts. C , Western blot analysis and quantification of AAV-treated cardiac tissues. D , Echocardiography of cardiac function and dimensions at 2 or 3 weeks after AAV treatment. E , Survival curve with the log-rank test between the CKO and CKO+AAV groups, * P <0.05. F , EET quantification of cardiac tissues by enzyme linked immunosorbent assay (ELISA) and mass-spectrometry analysis. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. n represents numbers of mice. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole. EET, epoxyeicosatrienoic acid.

Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

Techniques: Injection, Amplification, Sequencing, Western Blot, Enzyme-linked Immunosorbent Assay, Mass Spectrometry, Generated, MANN-WHITNEY

Journal: bioRxiv

Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

doi: 10.64898/2026.02.09.704693

Figure Lengend Snippet: A , Diagram of AAV vectors and the workflow of overexpressing nuclear EPHX2. AAV was injected subcutaneously at P1. B , Western blot analysis of EPHX2 overexpression. C , Immunofluorescence images show the expression and localization of EPHX2 in the myocardium of P14 mouse hearts. The yellow arrow points to the nucleus. D , Echocardiography of cardiac function and structure. E , Total DHET/EET in hearts by ultra performance liquid chromatography-tandem mass spectrometry (UPLC–MS/MS)-based lipidomic. 6 animals per group. The Kruskal-Wallis H test was used. ns, not significant. F , Schematic diagram of inactivating mutation sites in EPHX2 hydrolase. G , Work Flow for the detection of EPHX2 hydrolase activity. H , Dynamic curve of EPHX2 hydrolysis product concentration. I , Schematic diagram of AAV vectors and experimental workflow (left). Echocardiographic analysis of cardiac function in CKO mice (right). CKO mice were injected with 2×10 11 AAV9 to specifically overexpress hydrolase-deficient EPHX2 in cardiomyocyte nuclei at P1. Echocardiographic analysis was performed at P14. P values were generated by Mann-Whitney U test. * P <0.05, *** P <0.001, mean ± SD. n represents numbers of mice. HA, hemagglutinin. NLS, nuclear localization sequence. NES, nuclear export sequence. t-AUCB, trans-4-(4-[3-Adamantan-1-yl-ureido]-cyclohexyloxy)-benzoic acid, a small-molecule inhibitor of EPHX2 hydrolase activity. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.

Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

Techniques: Injection, Western Blot, Over Expression, Immunofluorescence, Expressing, Liquid Chromatography, Mass Spectrometry, Tandem Mass Spectroscopy, Mutagenesis, Activity Assay, Concentration Assay, Generated, MANN-WHITNEY, Sequencing

Journal: bioRxiv

Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

doi: 10.64898/2026.02.09.704693

Figure Lengend Snippet: A , Diagram of gene therapy of NLS knock-in via HDR. B , Work flow of the AAV-HDR system. C , Example of targeted cDNA amplicon-sequencing results. The edited genomic regions were analyzed using CRISPResso2 software, and the editing efficiencies of HDR and NHEJ were calculated separately. D , AAV dose-dependent editing efficiency in mouse hearts evaluated by amplicon sequencing. E , Immunofluorescence images and quantification of EPHX2-positive nucleus in myocardium. n=3. F , Western blot images and quantification of nuclear EPHX2. n=3. G , Diagram of AAV-HDR and control AAVs, and outcomes in Lmna F/F ; Rosa CAG-LSL-Cas9-tdGFP mice after treatment. H , Editing efficiency of HDR and NHEJ-mediated gene edting after 4×10 11 AAV treatment by amplicon sequencing. n=4. I , Echocardiogram analysis of AAV-HDR treated hearts. J , Western blot images and quantification of γH2AX in myocardium. P values were generated by Mann-Whitney U test. * P <0.05, ** P < 0.01, *** P < 0.001, mean ± SD. n represents numbers of mice. HDR, homology-directed repair. NHEJ, non-homologous end-joining. HA, homology arm. Cre, Cyclization recombination. LSL, loxP-stop-loxP. NLS, nuclear localization signal. KO, knock-out. KI, knock-in. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.

Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

Techniques: Knock-In, Amplification, Sequencing, Software, Immunofluorescence, Western Blot, Control, Generated, MANN-WHITNEY, Non-Homologous End Joining, Knock-Out

Journal: ACS Nano

Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection

doi: 10.1021/acsnano.5c11011

Figure Lengend Snippet: Caveolae-mediated endocytosis is inactive in Tregs. (a–c) Delivery efficiency on Flat RCF and nN RCF for the pathway-specific cargoes (a) transferrin (Tfn), (b) Dextran 3000, and (c) Dextran 10k. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (d–f) Representative flow cytometry histograms for the data presented in (a–c). (g) Delivery efficiency on Flat RCF and nN RCF for the caveolae-specific cargo cholera toxin B (CTxB). Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (h) Representative flow cytometry histograms for the data in (g). (i) Western blot of Caveolin-1 (CAV-1) expression in MG63 +ve and Treg −ve, with β-actin as loading control.

Article Snippet: The CAV-1 sgRNA target sequence (AUGUUGCCCUGUUCCCGGAU) was ordered from Synthego.

Techniques: Flow Cytometry, Western Blot, Expressing, Control

Journal: ACS Nano

Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection

doi: 10.1021/acsnano.5c11011

Figure Lengend Snippet: Caveolin 1 knockout abolishes nanoneedle transfection in MG63 cells. (a) Western blot of CAV-1 expression in MG63 knockout cell clones (MG63 −ve C1, C2, and C3) and MG63 (MG63 +ve). (b–d) Representative confocal fluorescence image of CAV-1 expression and localization in (b) MG63 +ve, (c) MG63 −ve, and (d) Treg −ve cells after 6 h incubation. Scale bar: 2 μm. (e) CAV-1 expression levels in MG63 +ve, MG63 −ve, and Tregs. One-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (f) Representative flow cytometry histograms of CTxB uptake in MG63 +ve and MG63 −ve for Flat and nN. (g) Cholera toxin B (CTxB) delivery efficiency in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (h) Representative flow cytometry histograms of transferrin (Tfn) uptake in MG63 +ve and MG63 −ve for Flat and nN. (i) Tfn delivery efficiency in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (j) Representative flow cytometry contour plots of the delivery ( Y -axis, Cy5 fluorescence) and transfection ( X -axis, eGFP fluorescence) of Cy5-eGFP in MG63 +ve and MG63 −ve for Flat and nN. (k) Delivery efficiency (Cy5 + cell population: Q1 + Q2) in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (l) MFI values of Cy5 for groups presented in (k). Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (m) Transfection efficiency (Cy5 + eGFP + cell population: Q2) in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA, followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (n) MFI values of eGFP fluorescence for groups presented in (m). Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA, followed by Tukey’s multiple comparisons test. p -values are indicated above the bars.

Article Snippet: The CAV-1 sgRNA target sequence (AUGUUGCCCUGUUCCCGGAU) was ordered from Synthego.

Techniques: Knock-Out, Transfection, Western Blot, Expressing, Clone Assay, Fluorescence, Incubation, Flow Cytometry

Journal: ACS Nano

Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection

doi: 10.1021/acsnano.5c11011

Figure Lengend Snippet: Caveolin 1 knock in induces nanoneedle transfection in Tregs. (a) Cell viability after nucleofection of CAV-1-mCherry into Tregs (Treg-KI) compared to untreated control. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bar. (b) Representative flow cytometry histogram for groups presented in (a). (c) Fraction of Treg-KI expressing mCherry compared to the untreated control. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (d) Representative flow cytometry histogram for groups presented in (c). (e) Uptake of caveolae-specific cargo cholera toxin B (CTxB) in nN RCF Treg-KI compared to the nN RCF Treg control (nN RCF Treg −ve). Data presented as mean ± SD, n = 3 independent samples, ordinary one-way ANOVA, followed by Tukey’s multiple comparisons test, p -values are indicated above the bars. (f) Representative flow cytometry histogram for groups presented in (e). (g) Nanoneedle transfection efficiency for purified Treg-KI (nN RCF Treg +ve) and nN RCF Treg −ve. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, and p -values are indicated above the bars. (h) Representative flow cytometry histogram for groups presented in (g).

Article Snippet: The CAV-1 sgRNA target sequence (AUGUUGCCCUGUUCCCGGAU) was ordered from Synthego.

Techniques: Knock-In, Transfection, Control, Flow Cytometry, Expressing, Purification