|
Genechem
sgrna sequences targeting cbx2 Sgrna Sequences Targeting Cbx2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sgrna sequences targeting cbx2/product/Genechem Average 86 stars, based on 1 article reviews
sgrna sequences targeting cbx2 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Addgene inc
grna sequences Grna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grna sequences/product/Addgene inc Average 93 stars, based on 1 article reviews
grna sequences - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Twist Bioscience
sgrna sequences Sgrna Sequences, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sgrna sequences/product/Twist Bioscience Average 86 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Benchling Inc
guide rna sgrna sequences Guide Rna Sgrna Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide rna sgrna sequences/product/Benchling Inc Average 86 stars, based on 1 article reviews
guide rna sgrna sequences - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Addgene inc
human pooled genome wide sgrna library brunello sequences addgene addgene Human Pooled Genome Wide Sgrna Library Brunello Sequences Addgene Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human pooled genome wide sgrna library brunello sequences addgene addgene/product/Addgene inc Average 90 stars, based on 1 article reviews
human pooled genome wide sgrna library brunello sequences addgene addgene - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Azenta
sgrna sequences Sgrna Sequences, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sgrna sequences/product/Azenta Average 86 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Addgene inc
ephx2 sgrna sequences ![]() Ephx2 Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ephx2 sgrna sequences/product/Addgene inc Average 95 stars, based on 1 article reviews
ephx2 sgrna sequences - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
|
Synthego Inc
cav 1 sgrna target sequence auguugcccuguucccggau ![]() Cav 1 Sgrna Target Sequence Auguugcccuguucccggau, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cav 1 sgrna target sequence auguugcccuguucccggau/product/Synthego Inc Average 86 stars, based on 1 article reviews
cav 1 sgrna target sequence auguugcccuguucccggau - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
Journal: bioRxiv
Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice
doi: 10.64898/2026.02.09.704693
Figure Lengend Snippet: A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic EPHX2 in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
Article Snippet:
Techniques: Immunofluorescence, Imaging, Isolation, Western Blot, Quantitative RT-PCR, Generated, MANN-WHITNEY
Journal: bioRxiv
Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice
doi: 10.64898/2026.02.09.704693
Figure Lengend Snippet: A , Diagram of AAV vectors and the workflow of knocking out Ephx2 . AAV was injected subcutaneously. B , Editing efficiency of Ephx2 by amplicon sequencing analysis in hearts. C , Western blot analysis and quantification of AAV-treated cardiac tissues. D , Echocardiography of cardiac function and dimensions at 2 or 3 weeks after AAV treatment. E , Survival curve with the log-rank test between the CKO and CKO+AAV groups, * P <0.05. F , EET quantification of cardiac tissues by enzyme linked immunosorbent assay (ELISA) and mass-spectrometry analysis. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. n represents numbers of mice. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole. EET, epoxyeicosatrienoic acid.
Article Snippet:
Techniques: Injection, Amplification, Sequencing, Western Blot, Enzyme-linked Immunosorbent Assay, Mass Spectrometry, Generated, MANN-WHITNEY
Journal: bioRxiv
Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice
doi: 10.64898/2026.02.09.704693
Figure Lengend Snippet: A , Diagram of AAV vectors and the workflow of overexpressing nuclear EPHX2. AAV was injected subcutaneously at P1. B , Western blot analysis of EPHX2 overexpression. C , Immunofluorescence images show the expression and localization of EPHX2 in the myocardium of P14 mouse hearts. The yellow arrow points to the nucleus. D , Echocardiography of cardiac function and structure. E , Total DHET/EET in hearts by ultra performance liquid chromatography-tandem mass spectrometry (UPLC–MS/MS)-based lipidomic. 6 animals per group. The Kruskal-Wallis H test was used. ns, not significant. F , Schematic diagram of inactivating mutation sites in EPHX2 hydrolase. G , Work Flow for the detection of EPHX2 hydrolase activity. H , Dynamic curve of EPHX2 hydrolysis product concentration. I , Schematic diagram of AAV vectors and experimental workflow (left). Echocardiographic analysis of cardiac function in CKO mice (right). CKO mice were injected with 2×10 11 AAV9 to specifically overexpress hydrolase-deficient EPHX2 in cardiomyocyte nuclei at P1. Echocardiographic analysis was performed at P14. P values were generated by Mann-Whitney U test. * P <0.05, *** P <0.001, mean ± SD. n represents numbers of mice. HA, hemagglutinin. NLS, nuclear localization sequence. NES, nuclear export sequence. t-AUCB, trans-4-(4-[3-Adamantan-1-yl-ureido]-cyclohexyloxy)-benzoic acid, a small-molecule inhibitor of EPHX2 hydrolase activity. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.
Article Snippet:
Techniques: Injection, Western Blot, Over Expression, Immunofluorescence, Expressing, Liquid Chromatography, Mass Spectrometry, Tandem Mass Spectroscopy, Mutagenesis, Activity Assay, Concentration Assay, Generated, MANN-WHITNEY, Sequencing
Journal: bioRxiv
Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice
doi: 10.64898/2026.02.09.704693
Figure Lengend Snippet: A , Diagram of gene therapy of NLS knock-in via HDR. B , Work flow of the AAV-HDR system. C , Example of targeted cDNA amplicon-sequencing results. The edited genomic regions were analyzed using CRISPResso2 software, and the editing efficiencies of HDR and NHEJ were calculated separately. D , AAV dose-dependent editing efficiency in mouse hearts evaluated by amplicon sequencing. E , Immunofluorescence images and quantification of EPHX2-positive nucleus in myocardium. n=3. F , Western blot images and quantification of nuclear EPHX2. n=3. G , Diagram of AAV-HDR and control AAVs, and outcomes in Lmna F/F ; Rosa CAG-LSL-Cas9-tdGFP mice after treatment. H , Editing efficiency of HDR and NHEJ-mediated gene edting after 4×10 11 AAV treatment by amplicon sequencing. n=4. I , Echocardiogram analysis of AAV-HDR treated hearts. J , Western blot images and quantification of γH2AX in myocardium. P values were generated by Mann-Whitney U test. * P <0.05, ** P < 0.01, *** P < 0.001, mean ± SD. n represents numbers of mice. HDR, homology-directed repair. NHEJ, non-homologous end-joining. HA, homology arm. Cre, Cyclization recombination. LSL, loxP-stop-loxP. NLS, nuclear localization signal. KO, knock-out. KI, knock-in. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.
Article Snippet:
Techniques: Knock-In, Amplification, Sequencing, Software, Immunofluorescence, Western Blot, Control, Generated, MANN-WHITNEY, Non-Homologous End Joining, Knock-Out
Journal: ACS Nano
Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection
doi: 10.1021/acsnano.5c11011
Figure Lengend Snippet: Caveolae-mediated endocytosis is inactive in Tregs. (a–c) Delivery efficiency on Flat RCF and nN RCF for the pathway-specific cargoes (a) transferrin (Tfn), (b) Dextran 3000, and (c) Dextran 10k. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (d–f) Representative flow cytometry histograms for the data presented in (a–c). (g) Delivery efficiency on Flat RCF and nN RCF for the caveolae-specific cargo cholera toxin B (CTxB). Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (h) Representative flow cytometry histograms for the data in (g). (i) Western blot of Caveolin-1 (CAV-1) expression in MG63 +ve and Treg −ve, with β-actin as loading control.
Article Snippet: The
Techniques: Flow Cytometry, Western Blot, Expressing, Control
Journal: ACS Nano
Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection
doi: 10.1021/acsnano.5c11011
Figure Lengend Snippet: Caveolin 1 knockout abolishes nanoneedle transfection in MG63 cells. (a) Western blot of CAV-1 expression in MG63 knockout cell clones (MG63 −ve C1, C2, and C3) and MG63 (MG63 +ve). (b–d) Representative confocal fluorescence image of CAV-1 expression and localization in (b) MG63 +ve, (c) MG63 −ve, and (d) Treg −ve cells after 6 h incubation. Scale bar: 2 μm. (e) CAV-1 expression levels in MG63 +ve, MG63 −ve, and Tregs. One-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (f) Representative flow cytometry histograms of CTxB uptake in MG63 +ve and MG63 −ve for Flat and nN. (g) Cholera toxin B (CTxB) delivery efficiency in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (h) Representative flow cytometry histograms of transferrin (Tfn) uptake in MG63 +ve and MG63 −ve for Flat and nN. (i) Tfn delivery efficiency in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (j) Representative flow cytometry contour plots of the delivery ( Y -axis, Cy5 fluorescence) and transfection ( X -axis, eGFP fluorescence) of Cy5-eGFP in MG63 +ve and MG63 −ve for Flat and nN. (k) Delivery efficiency (Cy5 + cell population: Q1 + Q2) in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (l) MFI values of Cy5 for groups presented in (k). Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (m) Transfection efficiency (Cy5 + eGFP + cell population: Q2) in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA, followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (n) MFI values of eGFP fluorescence for groups presented in (m). Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA, followed by Tukey’s multiple comparisons test. p -values are indicated above the bars.
Article Snippet: The
Techniques: Knock-Out, Transfection, Western Blot, Expressing, Clone Assay, Fluorescence, Incubation, Flow Cytometry
Journal: ACS Nano
Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection
doi: 10.1021/acsnano.5c11011
Figure Lengend Snippet: Caveolin 1 knock in induces nanoneedle transfection in Tregs. (a) Cell viability after nucleofection of CAV-1-mCherry into Tregs (Treg-KI) compared to untreated control. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bar. (b) Representative flow cytometry histogram for groups presented in (a). (c) Fraction of Treg-KI expressing mCherry compared to the untreated control. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (d) Representative flow cytometry histogram for groups presented in (c). (e) Uptake of caveolae-specific cargo cholera toxin B (CTxB) in nN RCF Treg-KI compared to the nN RCF Treg control (nN RCF Treg −ve). Data presented as mean ± SD, n = 3 independent samples, ordinary one-way ANOVA, followed by Tukey’s multiple comparisons test, p -values are indicated above the bars. (f) Representative flow cytometry histogram for groups presented in (e). (g) Nanoneedle transfection efficiency for purified Treg-KI (nN RCF Treg +ve) and nN RCF Treg −ve. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, and p -values are indicated above the bars. (h) Representative flow cytometry histogram for groups presented in (g).
Article Snippet: The
Techniques: Knock-In, Transfection, Control, Flow Cytometry, Expressing, Purification